Stem-loop sequence ppc-mir-8345

AccessionMI0027050 (change log)
DescriptionPristionchus pacificus miR-8345 stem-loop
Stem-loop
   --  uu      --    u    u   u  uc 
5'   uc  caguga  ucau caaa cca cu  a
     ||  ||||||  |||| |||| ||| ||   
3'   ag  gucacu  agua guuu ggu ga  a
   au  cu      cc    u    u   -  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000021.1: 1850281-1850341 [+]
intergenic
Database links

Mature sequence ppc-miR-8345-5p

Accession MIMAT0033236
Sequence

1 - 

ucuucagugaucauucaaaucc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppc-miR-8345-3p

Accession MIMAT0033237
Sequence

38 - 

uuuuguaugaccucacugucgaua

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).