Stem-loop sequence ppc-mir-8353

AccessionMI0027065 (change log)
DescriptionPristionchus pacificus miR-8353 stem-loop
Stem-loop
   --               cu        uag 
5'   auacaagucagauuc  uuucgcag   a
     |||||||||||||||  ||||||||   u
3'   uauguucagucugag  aaagcguu   g
   ag               -u        gaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000131.1: 502556-502615 [-]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-8353
ppc-mir-8334ABKE03000131.1: 505062-505121 [+]
ppc-mir-8339ABKE03000131.1: 504760-504819 [+]
ppc-mir-8339ABKE03000131.1: 504602-504661 [+]
ppc-mir-8339ABKE03000131.1: 504444-504503 [+]
ppc-mir-8353ABKE03000131.1: 502556-502615 [-]
ppc-mir-8238ABKE03000131.1: 501523-501582 [-]
ppc-mir-8259ABKE03000131.1: 499907-499966 [+]
Database links

Mature sequence ppc-miR-8353-5p

Accession MIMAT0033266
Sequence

1 - 

auacaagucagauuccuuuucgc

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppc-miR-8353-3p

Accession MIMAT0033267
Sequence

39 - 

gaaaugagucugacuuguauga

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).