Stem-loop sequence ppc-mir-8364t

AccessionMI0027074 (change log)
DescriptionPristionchus pacificus miR-8364t stem-loop
Stem-loop
   --        c  aa        ---ag  gg 
5'   ucuucauu cg  ugaucucu     uc  u
     |||||||| ||  ||||||||     ||  c
3'   agaaguaa gc  acuagaga     ag  a
   ag        a  gc        gugaa  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000124.1: 2040081-2040142 [+]
intergenic
Database links

Mature sequence ppc-miR-8364t-5p

Accession MIMAT0033284
Sequence

1 - 

ucuucauuccgaaugaucucu

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppc-miR-8364t-3p

Accession MIMAT0033285
Sequence

42 - 

agaucacgcgaaaugaagaga

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).