Stem-loop sequence ppc-mir-8362

AccessionMI0027077 (change log)
DescriptionPristionchus pacificus miR-8362 stem-loop
Stem-loop
   --  gc   u    ga  aaa      a 
5'   uc  uga guug  ca   gugauu u
     ||  ||| ||||  ||   |||||| u
3'   ag  auu cgac  gu   cgcuag u
   au  aa   u    -a  -ag      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000041.1: 1754384-1754438 [+]
intergenic
Database links

Mature sequence ppc-miR-8362-5p

Accession MIMAT0033290
Sequence

1 - 

ucgcugauguuggacaaaagu

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppc-miR-8362-3p

Accession MIMAT0033291
Sequence

36 - 

cgaugacagcuuuaaagaua

 - 55

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).