Stem-loop sequence str-mir-92

AccessionMI0027112 (change log)
DescriptionStrongyloides ratti miR-92 stem-loop
Stem-loop
   --       ag a  c  c     u   aua 
5'   agguugg  c ug gc auauu uug   g
     |||||||  | || || ||||| |||    
3'   uccggcc  g ac cg uauaa aau   a
   ag       cu c  a  u     u   auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSIv4) Overlapping transcripts
Sratti_scf00001_Chr02: 4795288-4795349 [-]
intergenic
Clustered miRNAs
< 10kb from str-mir-92
str-mir-92Sratti_scf00001_Chr02: 4795288-4795349 [-]
str-mir-71Sratti_scf00001_Chr02: 4788588-4788648 [-]
Database links

Mature sequence str-miR-92-5p

Accession MIMAT0033356
Sequence

1 - 

agguuggagcaugcgccauauu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence str-miR-92-3p

Accession MIMAT0033357
Sequence

41 - 

uauugcacacgucccggccuga

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).