Stem-loop sequence str-mir-87a

AccessionMI0027135 (change log)
DescriptionStrongyloides ratti miR-87a stem-loop
Stem-loop
   --       ga      ga    a   -  gauu 
5'   caucgga  cuuuug  cuca ccu ca    g
     |||||||  ||||||  |||| ||| ||     
3'   guggccu  gagaac  gagu gga gu    u
   gu       uc      --    -   a  auaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSIv4) Overlapping transcripts
Sratti_scf00001_Chr01: 3619840-3619903 [+]
intergenic
Database links

Mature sequence str-miR-87a-5p

Accession MIMAT0033402
Sequence

1 - 

caucggagacuuuuggacucaaccu

 - 25

Get sequence
Evidence experimental; Illumina [1]

Mature sequence str-miR-87a-3p

Accession MIMAT0033403
Sequence

43 - 

gugagcaagagcuuccggugug

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).