Stem-loop sequence str-mir-47

AccessionMI0027136 (change log)
DescriptionStrongyloides ratti miR-47 stem-loop
Stem-loop
   --           -   u  u    u  auau 
5'   uaggagagcug ucu ug cggu ga    u
     ||||||||||| ||| || |||| ||    a
3'   auucucucgau agg ac guca cu    g
   ag           g   u  u    u  gaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSIv4) Overlapping transcripts
Sratti_scf00002_Chr02: 5151393-5151456 [+]
intergenic
Database links

Mature sequence str-miR-47-5p

Accession MIMAT0033404
Sequence

1 - 

uaggagagcugucuuugucggu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence str-miR-47-3p

Accession MIMAT0033405
Sequence

42 - 

ugucauggaguagcucucuuaga

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).