Stem-loop sequence str-mir-8381

AccessionMI0027143 (change log)
DescriptionStrongyloides ratti miR-8381 stem-loop
Stem-loop
   --         -     -       -   cu 
5'   caaaaauuc gcaau caaaagc ugu  g
     ||||||||| ||||| ||||||| |||  a
3'   guuuuuaag cguua guuuucg aca  u
   ua         u     u       u   ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSIv4) Overlapping transcripts
Sratti_scf00001_Chr01: 2672084-2672143 [+]
intergenic
Clustered miRNAs
< 10kb from str-mir-8381
str-mir-8402Sratti_scf00001_Chr01: 2672081-2672142 [-]
str-mir-8381Sratti_scf00001_Chr01: 2672084-2672143 [+]
Database links

Mature sequence str-miR-8381-5p

Accession MIMAT0033418
Sequence

1 - 

caaaaauucgcaaucaaaagc

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence str-miR-8381-3p

Accession MIMAT0033419
Sequence

38 - 

uuuuguauugcugaauuuuugau

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).