Stem-loop sequence str-mir-58

AccessionMI0027166 (change log)
DescriptionStrongyloides ratti miR-58 stem-loop
Stem-loop
   --          -    a  g   ua  a 
5'   augacacuga auga cu acg  uc a
     |||||||||| |||| || |||  ||  
3'   uacugugauu uacu ga ugc  ag g
   uu          a    a  g   ua  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSIv4) Overlapping transcripts
Sratti_scf00001_Chr00: 1308359-1308415 [-]
intergenic
Clustered miRNAs
< 10kb from str-mir-58
str-mir-58Sratti_scf00001_Chr00: 1308359-1308415 [-]
str-mir-1175Sratti_scf00001_Chr00: 1299301-1299360 [-]
Database links

Mature sequence str-miR-58-5p

Accession MIMAT0033464
Sequence

1 - 

augacacugaaugaacugacg

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence str-miR-58-3p

Accession MIMAT0033465
Sequence

36 - 

ugagaucauauuagugucauuu

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).