Stem-loop sequence sma-mir-8410

AccessionMI0027203 (change log)
DescriptionSchistosoma mansoni miR-8410 stem-loop
Stem-loop
   gcuua      a   uuuuuu  -  c      guu     -      -     - ----     aa 
5'      auggaa uag      cu ca acacug   uacau uuauuc acugu c    ucaua  a
        |||||| |||      || || ||||||   ||||| |||||| ||||| |    |||||   
3'      uaccuu auu      ga gu ugugac   gugua aauaag ugaua g    aguau  u
   cuaua      -   ------  u  u      ---     u      c     a uuaa     ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_1: 26160408-26160525 [+]
intergenic
Database links

Mature sequence sma-miR-8410-5p

Accession MIMAT0033524
Sequence

5 - 

aauggaaauaguuuuuucuc

 - 24

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence sma-miR-8410-3p

Accession MIMAT0033525
Sequence

94 - 

aguguuuguaguuauuccau

 - 113

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).