Stem-loop sequence sma-mir-8422

AccessionMI0027215 (change log)
DescriptionSchistosoma mansoni miR-8422 stem-loop
Stem-loop
   g  uu         aacaaaaa   ---  a     -a     c   ga     au 
5'  ug  cuaagucgu        ugc   gc auuaa  aguag agu  uaauu  a
    ||  |||||||||        |||   || |||||  ||||| |||  |||||  a
3'  gc  gauucagca        aug   cg uaauu  uuauu uca  auuaa  a
   g  ug         -gauagaa   agu  a     gg     u   gg     ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_2: 12543004-12543113 [-]
intergenic
Database links

Mature sequence sma-miR-8422-5p

Accession MIMAT0033548
Sequence

26 - 

gcaauuaaaaguagcagug

 - 44

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence sma-miR-8422-3p

Accession MIMAT0033549
Sequence

60 - 

uuaggacuuuuauugguuaa

 - 79

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).