Stem-loop sequence sma-mir-281

AccessionMI0027237 (change log)
DescriptionSchistosoma mansoni miR-281 stem-loop
Literature search

2 open access papers mention sma-mir-281
(4 sentences)

Stem-loop
   acuaa     u    a   -   ua   a   agu       g        c         -----    --a        a    
5'      cauau agau aug ugu  uug auu   ucugaug agagagca uuuuaugac     ggaa   uaaugaaa ucu 
        ||||| |||| ||| |||  ||| |||   ||||||| |||||||| |||||||||     ||||   |||||||| || u
3'      gugua ucua uac acg  aac uga   ggacuau ucucucgu gagguacug     ccuu   guuauuuu agc 
   aauag     -    a   u   --   c   -uu       a        u         uaaua    gaa        a    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_4: 27195906-27196064 [-]
intergenic
Database links

Mature sequence sma-miR-281-5p

Accession MIMAT0033592
Sequence

42 - 

gagagagcacuuuuaugacgga

 - 63

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

Mature sequence sma-miR-281-3p

Accession MIMAT0033593
Sequence

102 - 

ugucauggaguugcucucuaua

 - 123

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

References

1
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).