Stem-loop sequence sma-mir-8482

AccessionMI0027284 (change log)
DescriptionSchistosoma mansoni miR-8482 stem-loop
Stem-loop
   agagu         ---ag    u         aaugg    a    aaug  aauaa  au 
5'      gugguuugc     acaa uacuuggug     guua uuau    ac     ca  a
        |||||||||     |||| |||||||||     |||| ||||    ||     ||   
3'      cacuaaaug     uguu augaaucgu     uaau agua    ug     gu  a
   auaau         aauua    u         -ggaa    g    -gaa  -gaua  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
SC_0199: 383413-383532 [-]
intergenic
Database links

Mature sequence sma-miR-8482-5p

Accession MIMAT0033685
Sequence

31 - 

aauggguuaauuauaaugac

 - 50

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence sma-miR-8482-3p

Accession MIMAT0033686
Sequence

71 - 

uaagaugaguaauaaggug

 - 89

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).