Stem-loop sequence sma-mir-8484

AccessionMI0027286 (change log)
DescriptionSchistosoma mansoni miR-8484 stem-loop
Stem-loop
   caaca    ---     auuuaacca  uaucac     a    uu             acac     -c    au 
5'      gguu   ugucu         gc      aguuu ccau  auuuuuuggaaga    ugcga  guuu  c
        ||||   |||||         ||      ||||| ||||  |||||||||||||    |||||  ||||   
3'      ccag   acgga         cg      uuaga ggua  uaaaaaauuuucu    augcu  caga  a
   cuuua    cau     --guuuaug  ----cu     a    -u             acua     ca    cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
SC_0309: 60872-61014 [-]
intergenic
Database links

Mature sequence sma-miR-8484-5p

Accession MIMAT0033689
Sequence

45 - 

uuuuuuggaagaacacugc

 - 63

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence sma-miR-8484-3p

Accession MIMAT0033690
Sequence

86 - 

uaaucaucuuuuaaaaaauua

 - 106

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).