Stem-loop sequence pxy-mir-8499a

AccessionMI0027302 (change log)
DescriptionPlutella xylostella miR-8499a stem-loop
Gene family MIPF0002029; mir-8499
Stem-loop
   acu      u   -               c     caa 
5'    gcgagg aaa caucgaccaaugaaa ugcau   a
      |||||| ||| ||||||||||||||| |||||   c
3'    cgcucc uuu guaguugguuacuuu acgua   g
   acu      -   a               a     cuc 
Get sequence
Deep sequencing
125 reads, 3.55e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_109: 1187623-1187699 [-]
intergenic
Database links

Mature sequence pxy-miR-8499a

Accession MIMAT0033709
Sequence

44 - 

augcaauuucauugguugauga

 - 65

Get sequence
Deep sequencing9 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1