Stem-loop sequence pxy-mir-8500

AccessionMI0027354 (change log)
DescriptionPlutella xylostella miR-8500 stem-loop
Stem-loop
   cuu        a        aau       a           a          cuau     ug    u            ca 
5'    aggcugcc guccacca   cggagug gcuagcggagc gugugcgaag    aaucg  caau gaauugcaugag  g
      |||||||| ||||||||   ||||||| ||||||||||| ||||||||||    |||||  |||| ||||||||||||  a
3'    uccgacgg cagguggu   gccucac cgaucgucucg cacacguuuc    uuagu  guug uuuaacguauuu  g
   uau        a        cuc       c           c          -acu     ug    c            uu 
Get sequence
Deep sequencing
9 reads, 450 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_622: 176059-176226 [+]
intergenic
Database links

Mature sequence pxy-miR-8500

Accession MIMAT0033760
Sequence

92 - 

augcaauuucguugguugau

 - 111

Get sequence
Deep sequencing9 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1