Stem-loop sequence pxy-mir-306-1

AccessionMI0027381 (change log)
DescriptionPlutella xylostella miR-306-1 stem-loop
Gene family MIPF0000313; mir-306
Literature search

2 open access papers mention pxy-mir-306-1
(8 sentences)

Stem-loop
   uaa  c        -uc            ga       uggu 
5'    cg agguccau   cagguacuaggu  cucugag    g
      || ||||||||   ||||||||||||  |||||||    c
3'    gc ucuaggua   guccgugguccg  gagacuc    a
   aua  -        caa            uc       uaua 
Get sequence
Deep sequencing
358 reads, 9.85e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_310: 37870-37954 [-]
intergenic
Database links

Mature sequence pxy-miR-306

Accession MIMAT0033787
Sequence

16 - 

ccagguacuaggugacucuga

 - 36

Get sequence
Deep sequencing622 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1