Stem-loop sequence atr-MIR8579

AccessionMI0027464 (change log)
DescriptionAmborella trichopoda miR8579 stem-loop
Stem-loop
   ccuucuuacacggggcaucaucaccucuaauacuggcaagauguuuauugaaucuauuuuuagu        aa              u             u      g      u  a c     aacacaaua  ucca       g    gg 
5'                                                                 ggcauuag  auauguccacaaaa uugcacaugauuu guuuuu ucauuc ug c gaguu         cu    uccuaaa uuuu  a
                                                                   ||||||||  |||||||||||||| ||||||||||||| |||||| |||||| || | |||||         ||    ||||||| ||||   
3'                                                                 cuguaauc  uauacagguguuuu aacguguauuaaa uaaaaa aguaag au g cucaa         ga    aggauuu aaaa  a
   --------ggaagaauuugccccgauguaguggugauuuuggcucuucuacaaguuaaauacgg        cg              u             -      g      c  a a     -gcuucuuc  ----       g    aa 
Get sequence
Deep sequencing
919 reads, 725 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00036: 4709046-4709345 [+]
intergenic
Database links

Mature sequence atr-miR8579

Accession MIMAT0033863
Sequence

277 - 

gugauguagccccguuuaagaagg

 - 300

Get sequence
Deep sequencing261 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).