Stem-loop sequence atr-MIR8552d

AccessionMI0027471 (change log)
DescriptionAmborella trichopoda miR8552d stem-loop
Gene family MIPF0001863; MIR8552
Stem-loop
              c     u                  c                          c     g  c       a   a           a            c        c       guaguuuuuu                         g          cg   uucucaucaaggcgcaccuaauaaaaaaauaaaaaaaauuaucugcaaaaaauaaaaugacuaaaauacccccugaa 
5' auauauauaua auaua gggaaaagaugggauuag ccacuagcucguaugaacauaugagc caaug cc agauuga ucu ggccgaucuga gaucacggaugu ugguagug uugaauu          uucuacagauccaaaucacuugaaa uuuaggugug  uuc                                                                             a
   ||||||||||| ||||| |||||||||||||||||| |||||||||||||||||||||||||| ||||| || ||||||| ||| ||||||||||| |||||||||||| |||||||| |||||||          ||||||||||||||||||||||||| ||||||||||  |||                                                                              
3' uauauauauau uauau cccuuuucuacccuaauc ggugaucgaguauacuuguauacucg guugc gg ucuaauu aga ccggcuagauu cuagugccuaca gccaucac aacuuaa          aagguguuuagguuuagugaacuuu aaauccgcac  aag                                                                             c
              a     -                  a                          a     a  a       a   c           g            a        a       ----------                         a          au   uaguuuuuauccacuuagaagcuuuuuauaguuuguuuauaaaauguacuuuauuuaacugguuuaugggggcuuuu 
Get sequence
Deep sequencing
8188 reads, 1.37e+04 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00042: 1550291-1550789 [+]
intergenic
Database links

Mature sequence atr-miR8552d

Accession MIMAT0033870
Sequence

395 - 

uccgugaucguuagaucggcccag

 - 418

Get sequence
Deep sequencing2648 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).