Stem-loop sequence atr-MIR166b

AccessionMI0027514 (change log)
DescriptionAmborella trichopoda miR166b stem-loop
Gene family MIPF0000004; MIR166
Stem-loop
   --------------augggg        uu    u             a   a      cuuuccauauguggaucaugugaacuugca 
5'                     ggaaaacc  ugug ggaaugagguuug ucc agaucu                              c
                       ||||||||  |||| ||||||||||||| ||| ||||||                              c
3'                     ccuuuugg  acac ccuuacuucggac agg ucuaga                              u
   uaccccaaaguuaaauaaca        uc    c             c   c      uaaguaucuucucccaaacgguuguacguu 
Get sequence
Deep sequencing
579891 reads, 1.58e+05 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00004: 1713840-1714006 [+]
intergenic
Database links

Mature sequence atr-miR166b

Accession MIMAT0033916
Sequence

112 - 

ucucggaccaggcuucauucc

 - 132

Get sequence
Deep sequencing579846 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).