Stem-loop sequence gra-MIR7502b

AccessionMI0027608 (change log)
DescriptionGossypium raimondii miR7502b stem-loop
Gene family MIPF0001869; MIR7502
Stem-loop
   cua        u               c    guacua    -c     cuuaacugauaaaauaaucag 
5'    guuauuuu guuaaaaguuucauc auuu      uuaa  auugg                     a
      |||||||| ||||||||||||||| ||||      ||||  |||||                      
3'    caguaaaa caauuuuuaaaguag uaaa      aauu  uaauc                     u
   agc        -               a    aauaac    uu     aaaaauaugcauuuauauuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Graimondii2_0; GCA_000327365.1) Overlapping transcripts
chr1: 614813-614952 [+]
intergenic
Database links

Mature sequence gra-miR7502b

Accession MIMAT0034013
Sequence

11 - 

uuguuaaaaguuucauccauu

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1