Stem-loop sequence gra-MIR7502c

AccessionMI0027609 (change log)
DescriptionGossypium raimondii miR7502c stem-loop
Gene family MIPF0001869; MIR7502
Stem-loop
   uua u       -   a          cc      uuaguuaaaaaauaguaacuguauguugacauaaaguacacauaacgu 
5'    g ucuuuuu guu aaaguuucau  auuuuu                                                a
      | ||||||| ||| ||||||||||  ||||||                                                a
3'    c agaaaaa caa uuuuaaagua  uaaaaa                                                u
   uga u       a   c          aa      ugggaauuuuuagcuauaccaaauaucuuaucgauuuaucacugugga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Graimondii2_0; GCA_000327365.1) Overlapping transcripts
chr5: 59731063-59731230 [-]
intergenic
Database links

Mature sequence gra-miR7502c

Accession MIMAT0034014
Sequence

11 - 

uuguuaaaaguuucauccauu

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1