Stem-loop sequence gra-MIR8691

AccessionMI0027659 (change log)
DescriptionGossypium raimondii miR8691 stem-loop
Stem-loop
   ugcuu           u             caa  ug  u   c    uugauuuuuauuugauugguuuguuauguucauguuagu 
5'      uuuuuagauga gagaaaggaaagu   ga  aa gaa aagu                                       c
        ||||||||||| |||||||||||||   ||  || ||| ||||                                        
3'      aaagguuuauu uuuuuuucuuuua   uu  uu cuu uucg                                       u
   uuauu           -             agg  gu  -   c    ugucuaauuuaggagucuggaucaaauucugaaaaaugg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Graimondii2_0; GCA_000327365.1) Overlapping transcripts
chr4: 19643915-19644088 [+]
intergenic
Database links

Mature sequence gra-miR8691

Accession MIMAT0034064
Sequence

11 - 

agaugaugagaaaggaaagucaag

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1