Stem-loop sequence gra-MIR8695

AccessionMI0027671 (change log)
DescriptionGossypium raimondii miR8695 stem-loop
Stem-loop
   ug    g  c        a   a      g           -ua         aaauacaucuauuaca 
5'   acau au aggaugua aag auaggu aaaggauuaag   uaucagaua                a
     |||| || |||||||| ||| |||||| |||||||||||   |||||||||                 
3'   ugua ua uccuacau uuc uaucca uuucuuaauuu   auagucuau                g
   ua    a  c        c   c      a           cua         aucuaauuaaaacaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Graimondii2_0; GCA_000327365.1) Overlapping transcripts
chr10: 37612026-37612164 [-]
intergenic
Database links

Mature sequence gra-miR8695

Accession MIMAT0034076
Sequence

11 - 

aggauguaaaagaauagguga

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1