Stem-loop sequence gra-MIR7492g

AccessionMI0027719 (change log)
DescriptionGossypium raimondii miR7492g stem-loop
Gene family MIPF0001661; MIR7492
Stem-loop
   c                             gu 
5'  gcuaaaggucgugaucuuuagcggcguuu  g
    |||||||||||||||||||||||||||||  a
3'  cgauuucuagugcuggaaaucgccgcgaa  u
   u                             aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Graimondii2_0; GCA_000327365.1) Overlapping transcripts
chr5: 55232926-55232992 [-]
intergenic
Database links

Mature sequence gra-miR7492g

Accession MIMAT0034124
Sequence

11 - 

cgugaucuuuagcggcguuug

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1