Stem-loop sequence gra-MIR7492h

AccessionMI0027720 (change log)
DescriptionGossypium raimondii miR7492h stem-loop
Gene family MIPF0001661; MIR7492
Stem-loop
   -         c                    gu 
5'  cgcuaaagg cgugaucuuuagcggcguuu  g
    ||||||||| ||||||||||||||||||||   
3'  gcgauuuuc guacuggaaaucgccgcgaa  u
   g         a                    aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Graimondii2_0; GCA_000327365.1) Overlapping transcripts
chr3: 19591404-19591470 [+]
intergenic
Database links

Mature sequence gra-miR7492h

Accession MIMAT0034125
Sequence

11 - 

cgugaucuuuagcggcguuug

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1