Stem-loop sequence gra-MIR7492i

AccessionMI0027721 (change log)
DescriptionGossypium raimondii miR7492i stem-loop
Gene family MIPF0001661; MIR7492
Stem-loop
   g  g      g ag                   ua  g            guuu  -    ug         acc 
5'  gc uuuucu g  aagcgccgcuaaagaucau  uc uuagcggcguuu    ug uaag  ccgcuaaag   a
    || |||||| |  |||||||||||||||||||  || ||||||||||||    || ||||  |||||||||    
3'  cg aaaagg u  uuugcggcgauuucuagug  ag aauugcugugaa    ac guuu  ggcgauuuc   u
   -  -      g -g                   cg  a            -aau  u    gu         cag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Graimondii2_0; GCA_000327365.1) Overlapping transcripts
chr3: 28533659-28533805 [+]
intergenic
Database links

Mature sequence gra-miR7492i

Accession MIMAT0034126
Sequence

117 - 

cgugaucuuuagcggcguuug

 - 137

Get sequence
Evidence experimental; Illumina [1]

References

1