Stem-loop sequence gra-MIR7492j

AccessionMI0027722 (change log)
DescriptionGossypium raimondii miR7492j stem-loop
Gene family MIPF0001661; MIR7492
Stem-loop
   -     a  gu                    gugggaa        c  a   uc 
5'  cgcua ag  cgugaucuuuagcggcguuu       aagcgccg ua agg  g
    ||||| ||  ||||||||||||||||||||       |||||||| || |||   
3'  gcgau uc  gcgcuggaaaucgccgcaaa       uuugcggc au ucu  c
   g     a  ug                    aggggug        c  a   gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Graimondii2_0; GCA_000327365.1) Overlapping transcripts
chr6: 43960593-43960703 [+]
intergenic
Database links

Mature sequence gra-miR7492j

Accession MIMAT0034127
Sequence

11 - 

cgugaucuuuagcggcguuug

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1