Stem-loop sequence gra-MIR167c

AccessionMI0027762 (change log)
DescriptionGossypium raimondii miR167c stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

2 open access papers mention gra-MIR167c
(11 sentences)

Stem-loop
   -   -uc  u  u   a           g        u a   c    ugu 
5'  ugc   ca ca cag ugaagcugcca caugaucu a uuu ccuc   u
    |||   || || ||| ||||||||||| |||||||| | ||| ||||   u
3'  acg   gu gu guc acuuugacggu guacuaga u aaa ggag   u
   c   uuc  c  u   c           -        c a   a    cua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Graimondii2_0; GCA_000327365.1) Overlapping transcripts
chr6: 48890368-48890469 [+]
intergenic
Database links

Mature sequence gra-miR167c

Accession MIMAT0034167
Sequence

11 - 

ucagaugaagcugccagcauga

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1