Stem-loop sequence gra-MIR7494f

AccessionMI0027769 (change log)
DescriptionGossypium raimondii miR7494f stem-loop
Gene family MIPF0001661; MIR7492
Stem-loop
   g    uug                       gu  a          gua 
5'  uuuu   gauaagcgccgcuaaagaucaug  cu uagcggcguu   a
    ||||   |||||||||||||||||||||||  || ||||||||||    
3'  aaga   uuauuuguggcgauuucuagugc  ga aucgccgcaa   a
   a    -ua                       uc  a          aag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Graimondii2_0; GCA_000327365.1) Overlapping transcripts
chr3: 36657946-36658044 [-]
intergenic
Database links

Mature sequence gra-miR7494f

Accession MIMAT0034174
Sequence

69 - 

ucgugaucuuuagcgguguuu

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1