Stem-loop sequence gra-MIR8749

AccessionMI0027770 (change log)
DescriptionGossypium raimondii miR8749 stem-loop
Stem-loop
   -     -gg  a          u                  u     c a             guauuccauggagagcccaaaggguucccggaauuuaagaagcaccuugacuaauggagauaugacuuguaagcucaugggagaaaugucaau 
5'  gggag   ug ucucggaccc caacggaagguauuguuc ugugu g gauuuugucucuc                                                                                             a
    |||||   || |||||||||| |||||||||||||||||| ||||| | |||||||||||||                                                                                              
3'  uccuu   gc agaguuuggg guugcuuuucauagcaag acaca c cuaaaacagagag                                                                                             u
   u     aca  c          -                  u     a c             aacauaaaacaccuacauuuccauuccggaaauucggaaccaaccaccaaacuugagggcguucgcguuauacguauuaauuauaaaacgugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Graimondii2_0; GCA_000327365.1) Overlapping transcripts
chr11: 60620749-60621059 [+]
intergenic
Clustered miRNAs
< 10kb from gra-MIR8749
gra-MIR8653achr11: 60619123-60619451 [+]
gra-MIR8653bchr11: 60619169-60619404 [-]
gra-MIR8749chr11: 60620749-60621059 [+]
Database links

Mature sequence gra-miR8749

Accession MIMAT0034175
Sequence

11 - 

ucucggacccucaacggaagg

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1