Stem-loop sequence gra-MIR8762a

AccessionMI0027787 (change log)
DescriptionGossypium raimondii miR8762a stem-loop
Gene family MIPF0001859; MIR8762
Stem-loop
   -                       a     c   c       c  c    auu    ---   ua      caucaa   a           uu   uu       a   c       uu   aaaa       a 
5'  gauggauaaguuaacauuuguua cuuug uga guggcau ua gugg   gucu   ugu  auguca      cag uaauuaauuuu  aaa  uuaaaaa auu aaaaaau  auu    uuauuua a
    ||||||||||||||||||||||| ||||| ||| ||||||| || ||||   ||||   |||  ||||||      ||| |||||||||||  |||  ||||||| ||| |||||||  |||    ||||||| a
3'  uuaucuauuuaauuguagacaau ggaac acu caucgua gu cacc   cagg   aca  uacggu      guu auuaauuaaaa  uuu  aauuuuu uaa uuuuuug  uaa    aauaaau a
   u                       -     a   a       a  a    -gu    ugu   --      acauuc   a           uu   uu       a   -       --   ----       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Graimondii2_0; GCA_000327365.1) Overlapping transcripts
chr6: 47375019-47375276 [-]
intergenic
Database links

Mature sequence gra-miR8762a

Accession MIMAT0034192
Sequence

11 - 

uuaacauuuguuaacuuugcugac

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1