Stem-loop sequence gra-MIR8762d

AccessionMI0027809 (change log)
DescriptionGossypium raimondii miR8762d stem-loop
Gene family MIPF0001859; MIR8762
Stem-loop
   -       gaa            a                   -auu  -   g         auugauuuuuuacaauuuuaaaaaauuguaaaaauucuuucuaaaaaauaaaaaaaa 
5'  aaguuaa   uuguuaacuuug ugauguggcauauaugugg    uc cau uggcaauua                                                         u
    |||||||   |||||||||||| |||||||||||||||||||    || ||| |||||||||                                                         a
3'  uucaauu   aacaauugaaac acuguacugugugugcacc    ag gua aucguuaau                                                         g
   c       aaa            g                   gaac  c   -         caauaaaaaauuuuugaaauuuuauaauuuuuuuaauauagaaacuauuagaaaauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Graimondii2_0; GCA_000327365.1) Overlapping transcripts
chr8: 53253449-53253687 [-]
intergenic
Database links

Mature sequence gra-miR8762d

Accession MIMAT0034214
Sequence

11 - 

uuguuaacuuugaugauguggcau

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1