Stem-loop sequence gra-MIR7484m

AccessionMI0027829 (change log)
DescriptionGossypium raimondii miR7484m stem-loop
Gene family MIPF0001667; MIR7484
Stem-loop
   -        c       u                  u   c       -   u  a       cau     -c       aacuaaucccuguaugucgacaugaggaauaugu 
5'  uaaauuag cuuugua guuagaucgaagagcaaa ugg ccuuuua uug aa uuucauc   uucua  uguuaaa                                  g
    |||||||| ||||||| |||||||||||||||||| ||| ||||||| ||| || |||||||   |||||  |||||||                                  g
3'  guuuaauc ggaauau caauuuaguuucucguuu auc ggaaaau aau uu aaaguag   aagau  auaauuu                                  c
   c        a       u                  c   a       c   u  a       -au     ua       gaucgcuacgacuaccuuauuggucuguaccgca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Graimondii2_0; GCA_000327365.1) Overlapping transcripts
chr13: 976428-976654 [-]
intergenic
Database links

Mature sequence gra-miR7484m

Accession MIMAT0034234
Sequence

11 - 

uuuguauguuagaucgaagag

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1