Stem-loop sequence cfa-mir-8790

AccessionMI0027870 (change log)
DescriptionCanis familiaris miR-8790 stem-loop
Stem-loop
   ca  a ag       cacaa     - ccc  g  --a     -g   -  c      cg   u 
5'   cc c  uuccgcc     uggag c   gu uc   ucacu  uag gu uggggu  agu a
     || |  |||||||     ||||| |   || ||   |||||  ||| || ||||||  |||  
3'   gg g  agggugg     accuc g   cg ag   agugg  guc ca gucccg  uca g
   -a  - ga       accgc     u ucc  g  ggg     aa   u  c      au   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr34: 12372846-12372968 [+]
intergenic
Database links

Mature sequence cfa-miR-8790

Accession MIMAT0034280
Sequence

31 - 

ugucaucacuguaggucugggguc

 - 54

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).