Stem-loop sequence cfa-mir-8832

AccessionMI0027918 (change log)
DescriptionCanis familiaris miR-8832 stem-loop
Stem-loop
   -   --      uaca  u   ca  c   u    cc   c   cca    --u   a    -      -  caccc 
5'  gcc  cauugu    ca ccu  gg agg ggcc  ggg cau   gggg   agg uuga uugugg ga     a
    |||  ||||||    || |||  || ||| ||||  ||| |||   ||||   ||| |||| |||||| ||     u
3'  cgg  guaaca    gu gga  cc uuc uugg  ccc gua   cccc   uuc gacu aacacc cu     g
   c   ug      --cg  -   ac  -   -    ac   u   uua    ucu   a    c      a  ccuac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr12: 3200669-3200813 [-]
intergenic
Database links

Mature sequence cfa-miR-8832

Accession MIMAT0034325
Sequence

41 - 

uccagggguaggauugauuguggga

 - 65

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).