Stem-loop sequence cfa-mir-1301

AccessionMI0027930 (change log)
DescriptionCanis familiaris miR-1301 stem-loop
Gene family MIPF0000742; mir-1301
Stem-loop
   gaac    cuaa c     -----c    au      u   g         - ug    - c      -  gu 
5'     ucug    g gaccc      uaga  ggggcu gug ggggucacu c  ggca c gcaaca cu  g
       ||||    | |||||      ||||  |||||| ||| ||||||||| |  |||| | |||||| ||  c
3'     agac    c cuggg      gucu  uccuga cac cuucaguga g  ccgu g cguugu gg  u
   -aca    ---c a     aacucc    -c      -   a         g gu    c a      a  ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr17: 19575798-19575932 [-]
intergenic
Database links

Mature sequence cfa-miR-1301

Accession MIMAT0034337
Sequence

76 - 

uugcagcugccugggagugacuuca

 - 100

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).