Stem-loop sequence cfa-mir-1343

AccessionMI0027953 (change log)
DescriptionCanis familiaris miR-1343 stem-loop
Gene family MIPF0001206; mir-1343
Stem-loop
   -accaa   --  au  u    u   u  u    a    c       -c     ucu 
5'       cga  ug  gc ggcu cgg gc gggg gcgg ccccggg  gggcc   g
         |||  ||  || |||| ||| || |||| |||| |||||||  |||||    
3'       gcu  ac  cg ccgg gcc cg ucuc cgcc ggggucc  cccgg   c
   ucgucg   cc  cu  c    -   u  c    a    c       uc     ucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr18: 32990094-32990204 [-]
sense
ENSCAFT00000011083 ; PDHX-201; intron 2
Database links

Mature sequence cfa-miR-1343

Accession MIMAT0034357
Sequence

64 - 

cuccuggggcccgcacucucgcu

 - 86

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).