Stem-loop sequence cfa-mir-8882

AccessionMI0027981 (change log)
DescriptionCanis familiaris miR-8882 stem-loop
Stem-loop
   -  g  g   u    u          g   -ccua     ucuccgagcucugacucccuucccugggaaaga 
5'  cu uc cuc guuu cugggcgcuu uac     cggcc                                 g
    || || ||| |||| |||||||||| |||     |||||                                  
3'  gg ag gag caaa gacucgugga gug     gucgg                                 c
   g  a  -   u    c          g   cucag     gcccauggaguuuggacgaugggacaaggacca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr8: 70657032-70657176 [-]
intergenic
Database links

Mature sequence cfa-miR-8882

Accession MIMAT0034384
Sequence

41 - 

uccgagcucugacucccuucccugg

 - 65

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).