Stem-loop sequence cfa-mir-8886

AccessionMI0027988 (change log)
DescriptionCanis familiaris miR-8886 stem-loop
Stem-loop
   caca    - ----g  uccag    uu   --     ag      ---au    --   c   a    -a     -  ga 
5'     gcua c     gu     gagc  gag  gugga  augccc     ccca  gga aug gugu  ggaca ca  c
       |||| |     ||     ||||  |||  |||||  ||||||     ||||  ||| ||| ||||  ||||| ||   
3'     cggu g     ca     cuug  cuc  caccu  ugcggg     gggu  ucu uau cacg  ccugu gu  c
   --ac    a aaaua  -uaua    -u   aa     cu      acacc    ag   -   g    aa     c  ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr9: 4378704-4378848 [+]
sense
ENSCAFT00000047537 ; QRICH2-201; intron 2
antisense
ENSCAFT00000008185 ; AANAT-201; intron 1
Database links

Mature sequence cfa-miR-8886

Accession MIMAT0034390
Sequence

41 - 

ucccaggacaugaguguaggacaca

 - 65

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).