Stem-loop sequence cfa-mir-6516

AccessionMI0027991 (change log)
DescriptionCanis familiaris miR-6516 stem-loop
Gene family MIPF0001672; mir-6516
Stem-loop
   --  --c    uu  c  -  -     ug a         a  g ug   a    cu   a 
5'   gg   ccag  cc cc cg ggguu  g uuugcagua ca g  uga cauu  agc g
     ||   ||||  || || || |||||  | ||||||||| || |  ||| ||||  |||  
3'   cc   gguc  gg gg gc cccag  c aaacgucau gu u  acu guag  uug c
   cg  uuc    -u  a  c  g     ga -         a  a gu   a    -u   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr9: 3776763-3776877 [-]
sense
ENSCAFT00000042192 ; SCARNA16-201; exon 1
Database links

Mature sequence cfa-miR-6516

Accession MIMAT0034393
Sequence

26 - 

uuugcaguaacaggugugaacauuc

 - 50

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).