Stem-loop sequence eca-mir-8931

AccessionMI0028067 (change log)
DescriptionEquus caballus miR-8931 stem-loop
Stem-loop
   --ag    cc   --   -      guuu    cu  au   ggg       u    auc 
5'     gcuc  agg  aga ugggca    gagg  gg  ucu   ccuaccc gguc   u
       ||||  |||  ||| ||||||    ||||  ||  |||   ||||||| ||||    
3'     cgag  ucc  ucu acccgu    cucc  cc  aga   ggguggg ccgg   c
   ccga    ac   ac   c      --gu    --  --   --a       u    gga 
Get sequence
Deep sequencing
41 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
NW_001867941.1: 119766-119874 [-]
intergenic
Database links

Mature sequence eca-miR-8931

Accession MIMAT0034459
Sequence

63 - 

ccugggugggaagaccccucug

 - 84

Get sequence
Deep sequencing33 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).