Stem-loop sequence eca-mir-8934-1

AccessionMI0028072 (change log)
DescriptionEquus caballus miR-8934-1 stem-loop
Gene family MIPF0002010; mir-8934
Stem-loop
   -----------u      caugaaaac      ccaa    --    g         ugg      -   ua  ----      ga 
5'             gguccc         gggcag    ggug  gcuc gggggcccc   aggccu cug  cc    ccacuu  g
               ||||||         ||||||    ||||  |||| |||||||||   |||||| |||  ||    ||||||   
3'             ccaggg         uucguc    ccac  cggg cccccgggg   uucgga gac  gg    gguggg  a
   cacguggagagu      --------u      cuug    cu    a         ---      c   gg  ugac      aa 
Get sequence
Deep sequencing
30 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
NW_001867853.1: 194530-194674 [-]
intergenic
Database links

Mature sequence eca-miR-8934

Accession MIMAT0034463
Sequence

41 - 

ccccuggaggccucuguaccccacu

 - 65

Get sequence
Deep sequencing58 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).