Stem-loop sequence eca-mir-8948

AccessionMI0028095 (change log)
DescriptionEquus caballus miR-8948 stem-loop
Stem-loop
   -------     -----a     -     ac     auguucuu  u  ug ---a  -       c  a  u 
5'        cccuc      cccca cuuag  agggc        gg gu  g    ag ccaggcc gg gu g
          |||||      ||||| |||||  |||||        || ||  |    || ||||||| || || c
3'        gggag      ggggu gaguc  uccug        uc ca  c    uc gguccgg uc cg c
   ucgugga     ggaaga     c     cc     -------g  -  gu ggug  a       -  a  a 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr23: 50337973-50338095 [-]
intergenic
Database links

Mature sequence eca-miR-8948

Accession MIMAT0034477
Sequence

31 - 

ugguguuggaagccaggcccggag

 - 54

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).