Stem-loop sequence eca-mir-8958

AccessionMI0028111 (change log)
DescriptionEquus caballus miR-8958 stem-loop
Stem-loop
   --------     uaa   --a    ugu  auca     gag     a          u       cu    --   u 
5'         aggca   aau   agga   gc    ugugg   ggagg aggaugauug cccuuug  gcuu  cca g
           |||||   |||   ||||   ||    |||||   ||||| |||||||||| |||||||  ||||  |||  
3'         uccgu   uug   uccu   ug    acacc   ucucc uucuauuaau gggagac  cgag  ggu g
   uagguacu     -ug   gcg    cuu  ----     ---     a          u       -u    ug   c 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr21: 11650786-11650924 [-]
sense
ENSECAT00000025742 ; ZSWIM6-201; intron 7
Database links

Mature sequence eca-miR-8958

Accession MIMAT0034492
Sequence

41 - 

ggaugauugucccuuugcugcu

 - 62

Get sequence
Deep sequencing6 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).