Stem-loop sequence eca-mir-8970

AccessionMI0028126 (change log)
DescriptionEquus caballus miR-8970 stem-loop
Stem-loop
   ggcg     - gga       ccag     auaagaa   a          ---            auu   u  a 
5'     gcggg c   ggcgugg    gcagu       cgg gggggcggcg   gcgcuacggcuc   cgg gc g
       ||||| |   |||||||    |||||       ||| ||||||||||   ||||||||||||   ||| ||  
3'     cgucc g   ccgcacc    cgucg       guc uccucgccgc   ugugaugucggg   guc cg c
   ----     a aaa       ----     ----ggg   g          gcc            --g   -  u 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr5: 51512258-51512392 [-]
sense
ENSECAT00000020819 ; FAM46C-201; 5'UTR (exon 1)
Database links

Mature sequence eca-miR-8970

Accession MIMAT0034507
Sequence

76 - 

gccugggggcuguaguguccgcgcc

 - 100

Get sequence
Deep sequencing7 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).