Stem-loop sequence eca-mir-8983

AccessionMI0028139 (change log)
DescriptionEquus caballus miR-8983 stem-loop
Stem-loop
     -   a  a   ga          caagcaa    ugaa ug  a    a     -  c   - c  ug  c  ugu 
5' gg agg ga guu  ggcagguggu       gucc    g  cg ugug cucag ag cag c gc  gg gc   c
   || ||| || |||  ||||||||||       ||||    |  || |||| ||||| || ||| | ||  || ||   c
3' cc ucc cu cag  ccguccgccg       uagg    c  gu gcac gaguc uc guc g cg  cc cg   c
     g   -  c   uc          -------    --uc gu  c    -     g  c   a u  gu  c  ucc 
Get sequence
Deep sequencing
9 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr7: 22665788-22665932 [+]
intergenic
Database links

Mature sequence eca-miR-8983

Accession MIMAT0034520
Sequence

41 - 

ugcgaugugacucagagccagccgc

 - 65

Get sequence
Deep sequencing6 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).