Stem-loop sequence eca-mir-9026

AccessionMI0028190 (change log)
DescriptionEquus caballus miR-9026 stem-loop
Stem-loop
   accccagu    g   uca    ccca      aagga  -     --    --   u  a     g  ga    gu a 
5'         ggac cgc   cggg    gugugg     gc ugucc  gagg  guc gc ucagg cu  gcau  c g
           |||| |||   ||||    ||||||     || |||||  ||||  ||| || ||||| ||  ||||  |  
3'         ccug gcg   gccc    cacacu     ug acggg  cucc  cag cg agucu gg  cgug  g a
   -------u    g   -ua    ---c      gcggg  c     ac    ua   u  -     g  gc    ag g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr26: 40551612-40551754 [+]
intergenic
Database links

Mature sequence eca-miR-9026

Accession MIMAT0034568
Sequence

41 - 

uguccgagggucugcaucagggcu

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).