Stem-loop sequence eca-mir-9037

AccessionMI0028201 (change log)
DescriptionEquus caballus miR-9037 stem-loop
Stem-loop
   aa   ag    ga  ca  cu  -    ---      c --aua      c    a       g gg 
5'   cgc  cucu  gc  ga  ug ggga   gcugcc g     ggguca aggg cgugaga u  g
     |||  ||||  ||  ||  || ||||   |||||| |     |||||| |||| ||||||| |  c
3'   gcg  gagg  cg  cu  ac cccu   cggcgg c     cccagu uucc gcacucu g  c
   --   -g    -a  -a  uu  u    cuc      a cgucc      c    -       g gu 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr25: 28482218-28482342 [-]
antisense
ENSECAT00000009624 ; GPR144-201; intron 24
Database links

Mature sequence eca-miR-9037

Accession MIMAT0034579
Sequence

71 - 

ucacgccuucugacccccug

 - 90

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).