Stem-loop sequence eca-mir-9063

AccessionMI0028236 (change log)
DescriptionEquus caballus miR-9063 stem-loop
Stem-loop
   agcuugggaauaggggacagacacauguccuucuuua   -  --  c      -a  uuaca    -     uc g 
5'                                      gag cu  gg gccuug  cc     ucag uggug  c a
                                        ||| ||  || ||||||  ||     |||| |||||  |  
3'                                      cuc ga  cc cggaac  gg     aguc aucgu  g g
   ----------------------------gucuucccc   u  gu  -      aa  cagag    u     -c a 
Get sequence
Deep sequencing
14 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr2: 44648638-44648758 [+]
sense
ENSECAT00000018757 ; NPHP4-202; intron 20
ENSECAT00000018688 ; NPHP4-201; intron 21
Database links

Mature sequence eca-miR-9063

Accession MIMAT0034608
Sequence

69 - 

uccgagagcugcuaucugagaga

 - 91

Get sequence
Deep sequencing6 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).